Review



experimental models c57bl 6j mice jackson laboratory  (Jackson Laboratory)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Jackson Laboratory experimental models c57bl 6j mice jackson laboratory
    Experimental Models C57bl 6j Mice Jackson Laboratory, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/a+experimental+models+n+paper/pm42104012-225-12-16
    Average 86 stars, based on 1 article reviews
    experimental models c57bl 6j mice jackson laboratory - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Virus:

    Article Title: IFN-stimulated metabolite transporter ENT3 facilitates viral genome release.
    Article Snippet: .. Reagent/Resource Reference or Source Identifier or Catalog Number Experimental Models C57BL/6J (M. musculus) Jackson Laboratory JAX stock#000664 ENT3fl/fl (M. musculus) This study N/A Cx3cr1cre/+ (M. musculus) Jackson Laboratory JAX stock#025524 ENT3 / (M. musculus) Hsu et al (2012) N/A MyD88 / (M. musculus) Hou et al (2008) JAX stock#009088 IFNAR1 / (M. musculus) Chen et al (2013a) N/A STAT1 / (M. musculus) Durbin et al (1996) JAX stock#012606 Calu-3 cells (H. sapiens) ATCC Cat#HTB-55 293T cells (H. sapiens) ATCC Cat#CRL-3216 RD cells (H. sapiens) ATCC Cat#CCL-136 VERO C1008 cells (C. aethiops) ATCC Cat#CRL-1586 THP-1 cells (H. sapiens) ATCC Cat#TIB-202 Escherichia coli DH5a Protech Cat#PT-FTDH5 Escherichia coli BL21-GFP Laboratory of Jie-Rong Huang (NYCU) N/A Encephalomyocarditis virus ATCC Cat#VR-1479 EV-A71/Taiwan/4643/1998 Laboratory of Lih-Hwa Hwang (NYCU) GenBank accession number#AF304458 hCoV-19/Taiwan/NTU13/2020 Laboratory of Sui-Yuan Chang (NTU) GISAID accession number#EPI_ISL_422415 14 of 22 EMBO reports 24: e55286 | 2023 2023 The Authors D ow nloaded from https://w w w .em bopress.org on July 27, 2025 from IP 2401:4900:1ce2:7641:99a4:92d3:7018:9b41. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number hCoV-19/Taiwan/NTU92/2021 Laboratory of Sui-Yuan Chang (NTU) GISAID accession number#EPI_ISL_3979387 Recombinant DNA pUC19 Protech N/A pLKO-human shENT3 National RNAi Core Facility Plateform, Taiwan Clone ID#TRCN0000043679 pLKO-human scrambled shRNA National RNAi Core Facility Plateform, Taiwan Clone ID#ASN0000000004 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 Antibodies Rabbit polyclonal anti-Stat1 antibody Cell Signaling Technology Cat#9172 Oligonucleotides and other sequence-based reagents Mouse Slc29a3 (qPCR primers) Thermo Fisher Scientific Mm00469913_m1 Mouse Ifnb1 (qPCR primers) Thermo Fisher Scientific Mm00439552_s1 Mouse Rpl19 (qPCR primers) Thermo Fisher Scientific Mm02601633_g1 Human SLC29A3 (qPCR primers) Thermo Fisher Scientific Hs00217911_m1 Human RPLP0 (qPCR primers) Thermo Fisher Scientific Hs99999902_m1 EMCV-2A2B forward 50-AATGCCCACTACGCTGGT-30 (qPCR primers) Vangrysperre et al (1996) N/A EMCV-2A2B reverse 50-GTCGTTCGGCAGTAGGGT-30 (qPCR primers) Vangrysperre et al (1996) N/A EV71/4643-3D forward 50- CCAAGATGAGCATGGAGGAT 30 (qPCR primers) Su et al (2018) N/A EV71/4643-3D reverse 50GATCTTGTCGATGGCCCTAA 30 (qPCR primers) Su et al (2018) N/A E_Sarbeco_F1 50- ACAGGTACGTTAATAGTTAATAGCGT-30 (qPCR primers) Corman et al (2020a) N/A E_Sarbeco_R2 50-ATATTGCAGCAGTACGCACACA-30 (qPCR primers) Corman et al (2020b) N/A Human IFNB1 forward 50- AGGACAGGATGAACTTTGAC-30 (qPCR primers) Li et al (2016a) N/A Human IFNB1 reverse 50- TGATAGACATTAGCCAGGAG-30 (qPCR primers) Li et al (2016b) N/A Human RPLP0 forward 50- CATGCTCAACATCTCCCCCTTCTT-30 (qPCR primers) This paper N/A Human RPLP0 reverse 50- GGGAAGGTGTAATCCGTCTCCACAG-30 (qPCR primers) This paper N/A Mouse Rpl19 forward 50- GACCGCCATATGTATCACAGC-30 (qPCR primers) This paper N/A Mouse Rpl19 reverse 50-TTTCGTGCTTCCTTGGTCTT30 (qPCR primers) This paper N/A Mouse B2m forward 50- CTGCTACGTAACACAGTTCCACCC-30 (qPCR primers) Bouchareychas et al (2020) N/A Mouse B2m reverse 50- CATGATGCTTGATCACATGTCTCG-30 (qPCR primers) Bouchareychas et al (2020) N/A Mouse Gapdh forward 50- TGAAGCAGGCATCTGAGGG-30 (qPCR primers) Bouchareychas et al (2020) N/A Mouse Gapdh reverse 50- CGAAGGTGGAAGAGTGGGAG-30 (qPCR primers) Bouchareychas et al (2020) N/A 2023 The Authors EMBO reports 24: e55286 | 2023 15 of 22 D ow nloaded from https://w w w .em bopress.org on July 27, 2025 from IP 2401:4900:1ce2:7641:99a4:92d3:7018:9b41.



    Similar Products

    experimental models hek 293 cells h sapiens atcc crl 1573 c57bl 6j  (ATCC)
    99
    ATCC experimental models hek 293 cells h sapiens atcc crl 1573 c57bl 6j
    Experimental Models Hek 293 Cells H Sapiens Atcc Crl 1573 C57bl 6j, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/293%3B+Embryonic+Kidney%3B+Human/pm41238795-170-12-17
    Average 99 stars, based on 1 article reviews
    experimental models hek 293 cells h sapiens atcc crl 1573 c57bl 6j - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    experimental model animals c57bl 6j mice  (Charles River Laboratories)
    86
    Charles River Laboratories experimental model animals c57bl 6j mice
    Experimental Model Animals C57bl 6j Mice, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/balb+c+mice/pm42168221-335-1-9
    Average 86 stars, based on 1 article reviews
    experimental model animals c57bl 6j mice - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    experimental models c57bl 6j mice jackson laboratory  (Jackson Laboratory)
    86
    Jackson Laboratory experimental models c57bl 6j mice jackson laboratory
    Experimental Models C57bl 6j Mice Jackson Laboratory, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/a+experimental+models+n+paper/pm42104012-225-12-16
    Average 86 stars, based on 1 article reviews
    experimental models c57bl 6j mice jackson laboratory - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    experimental mouse model specific pathogen free spf c57bl 6j mice  (Huafukang Technology)
    86
    Huafukang Technology experimental mouse model specific pathogen free spf c57bl 6j mice
    Experimental Mouse Model Specific Pathogen Free Spf C57bl 6j Mice, supplied by Huafukang Technology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/6j+c57bl+mice/pm41507139-122-15-30
    Average 86 stars, based on 1 article reviews
    experimental mouse model specific pathogen free spf c57bl 6j mice - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    experimental models c57bl 6j kitwv j  (Jackson Laboratory)
    86
    Jackson Laboratory experimental models c57bl 6j kitwv j
    Experimental Models C57bl 6j Kitwv J, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/a+experimental+models+n+paper/pm41233591-383-12-15
    Average 86 stars, based on 1 article reviews
    experimental models c57bl 6j kitwv j - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    experimental models c57bl 6j mice  (Jackson Laboratory)
    86
    Jackson Laboratory experimental models c57bl 6j mice
    Experimental Models C57bl 6j Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/6j+c57bl+jackson+laboratories+mice/pm41057229-142-8-12
    Average 86 stars, based on 1 article reviews
    experimental models c57bl 6j mice - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    experimental models c57bl 6j trnaala mice kauppila et  (ATCC)
    99
    ATCC experimental models c57bl 6j trnaala mice kauppila et
    Experimental Models C57bl 6j Trnaala Mice Kauppila Et, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/C57BL%2F6/pm40204990-181-12-31
    Average 99 stars, based on 1 article reviews
    experimental models c57bl 6j trnaala mice kauppila et - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    experimental models c57bl 6j  (ATCC)
    99
    ATCC experimental models c57bl 6j
    Experimental Models C57bl 6j, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/C2C12/pm40263624-263-12-21
    Average 99 stars, based on 1 article reviews
    experimental models c57bl 6j - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    experimental models: organisms / strains mouse / c57bl/6j jackson laboratory, #000664  (Jackson Laboratory)
    90
    Jackson Laboratory experimental models: organisms / strains mouse / c57bl/6j jackson laboratory, #000664
    Experimental Models: Organisms / Strains Mouse / C57bl/6j Jackson Laboratory, #000664, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/c57bl+6j+mice/pm40118063-249-21-27
    Average 90 stars, based on 1 article reviews
    experimental models: organisms / strains mouse / c57bl/6j jackson laboratory, #000664 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    experimental models c57bl 6j jackson laboratory  (Jackson Laboratory)
    86
    Jackson Laboratory experimental models c57bl 6j jackson laboratory
    Experimental Models C57bl 6j Jackson Laboratory, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/experimental+models+c57bl+6j/a+experimental+models+n+paper/pm39900735-198-5-8
    Average 86 stars, based on 1 article reviews
    experimental models c57bl 6j jackson laboratory - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results